What is a segment of DNA that codes for a specific protein or RNA molecule?

What is a segment of DNA that codes for a specific protein or RNA molecule?

Genes are segments of deoxyribonucleic acid (DNA) that contain the code for a specific protein that functions in one or more types of cells in the body.

What is the name of a segment of DNA that codes a particular polypeptide?

The segment of DNA molecules which codes or specifies for one polypeptide chain is called as gene. A gene is the basic physical and functional unit of heredity. Genes, which are made up of DNA, acts as instructions to make proteins.

What are DNA sequences that code for proteins called?

A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or stop signal during protein synthesis. DNA and RNA molecules are written in a language of four nucleotides; meanwhile, the language of proteins includes 20 amino acids.

What is a section of DNA that holds instructions for making a polypeptide?

a gene is a length of DNA that codes for a single polypeptide chain. during transcription a copy is made of a gene, or genes, worth of information.

Which of the following DNA segments do not code for proteins?

The introns do not code for any protein and are removed from the mRNA before it is made into protein. The exons are the sequences that code for protein. However, some exons are removed from the mRNA as well and do not get made into protein. This process of removing introns and exons from RNA is known as gene splicing.

Which type of DNA segment is used to form the protein coding sequence in mRNA?

Making mRNA To make mRNA, the coding strand of the DNA double helix is used as the template to polymerize the complementary bases into mRNA: if there is a C in the DNA there will be a G in the mRNA, if a T in the DNA then an A in the RNA, etc.

What a segment of DNA can code for?

A segment of a DNA molecule (a sequence of bases) that codes for a particular protein and determines the traits (phenotype) of the individual. A gene is the basic unit of heredity in a living organism.

What is the mRNA code for a protein?

Each group of three bases in mRNA constitutes a codon, and each codon specifies a particular amino acid (hence, it is a triplet code). The mRNA sequence is thus used as a template to assemble—in order—the chain of amino acids that form a protein.

Which mRNA will be translated to a polypeptide chain containing 8 amino acids?

AUGAGACGGACUGCAUUCCCAACCUGA
AUGAGACGGACUGCAUUCCCAACCUGA will be translated to a polypeptide chain containing 8 amino acids.

What is the process of making RNA from DNA?

The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to produce proteins is called translation.

You Might Also Like